Transcript: Mouse XM_017322202.1

PREDICTED: Mus musculus trinucleotide repeat containing 6a (Tnrc6a), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tnrc6a (233833)
Length:
8665
CDS:
497..6253

Additional Resources:

NCBI RefSeq record:
XM_017322202.1
NBCI Gene record:
Tnrc6a (233833)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254028 CTAATTACTCTGGCGACAAAT pLKO_005 2058 CDS 100% 13.200 18.480 N Tnrc6a n/a
2 TRCN0000265473 CTCCGTCTAATCGGCAATATG pLKO_005 6711 3UTR 100% 13.200 18.480 N Tnrc6a n/a
3 TRCN0000254027 GGATAAATCCATTCGTTAAAC pLKO_005 4077 CDS 100% 13.200 18.480 N Tnrc6a n/a
4 TRCN0000254029 TCATCAAATGGAGGGTTAAAT pLKO_005 1529 CDS 100% 15.000 12.000 N Tnrc6a n/a
5 TRCN0000150256 GCACTGTAAGTTCTTCATCAA pLKO.1 1515 CDS 100% 4.950 3.960 N TNRC6A n/a
6 TRCN0000254026 CCTTGTCTACGTGGGATAATT pLKO_005 5703 CDS 100% 15.000 10.500 N Tnrc6a n/a
7 TRCN0000364732 CCTTGTCTACGTGGGATAATT pLKO_005 5703 CDS 100% 15.000 10.500 N TNRC6A n/a
8 TRCN0000364712 GAATCATGCAGGCCAATATTA pLKO_005 6475 3UTR 100% 15.000 10.500 N TNRC6A n/a
9 TRCN0000147244 GCAAACATGGTGCTATTTCAA pLKO.1 5139 CDS 100% 5.625 3.938 N TNRC6A n/a
10 TRCN0000369459 GATCTGCTGTTAAGGTGTTAA pLKO_005 969 CDS 100% 13.200 7.920 N TNRC6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322202.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11864 pDONR223 100% 6% 5.9% None (many diffs) n/a
2 ccsbBroad304_11864 pLX_304 0% 6% 5.9% V5 (many diffs) n/a
Download CSV