Transcript: Mouse XM_017322348.1

PREDICTED: Mus musculus ubiquitin-like modifier activating enzyme 2 (Uba2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Uba2 (50995)
Length:
2180
CDS:
76..1824

Additional Resources:

NCBI RefSeq record:
XM_017322348.1
NBCI Gene record:
Uba2 (50995)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433196 GATAGTGTTGGAAGGATTAAA pLKO_005 1260 CDS 100% 15.000 12.000 N Uba2 n/a
2 TRCN0000007472 GCACCAGATGTCCAAATTGAA pLKO.1 1498 CDS 100% 5.625 4.500 N UBA2 n/a
3 TRCN0000272902 GCACCAGATGTCCAAATTGAA pLKO_005 1498 CDS 100% 5.625 4.500 N UBA2 n/a
4 TRCN0000040479 CCAGACTATAATGTGGAGTTT pLKO.1 370 CDS 100% 4.950 3.960 N Uba2 n/a
5 TRCN0000423679 CAAACCTCAGGATGCACATTT pLKO_005 1145 CDS 100% 13.200 9.240 N Uba2 n/a
6 TRCN0000425493 CATCGTATGGGCCAAGTATTT pLKO_005 630 CDS 100% 13.200 9.240 N Uba2 n/a
7 TRCN0000432359 GAGACTCTGCGAGTCCATTTA pLKO_005 1048 CDS 100% 13.200 9.240 N Uba2 n/a
8 TRCN0000415173 ATACTTTGCTGATCAACATTC pLKO_005 1646 CDS 100% 10.800 7.560 N Uba2 n/a
9 TRCN0000040481 CCCAACACCAACTGTTACGTT pLKO.1 1378 CDS 100% 3.000 2.100 N Uba2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07539 pDONR223 100% 81.2% 88.2% None (many diffs) n/a
2 ccsbBroad304_07539 pLX_304 0% 81.2% 88.2% V5 (many diffs) n/a
3 TRCN0000473116 TTCTGCAATGCAATCGGTGTTCCA pLX_317 18.7% 81.2% 88.2% V5 (many diffs) n/a
Download CSV