Transcript: Mouse XM_017322377.1

PREDICTED: Mus musculus zinc finger protein 235 (Zfp235), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp235 (56525)
Length:
3409
CDS:
20..2431

Additional Resources:

NCBI RefSeq record:
XM_017322377.1
NBCI Gene record:
Zfp235 (56525)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426347 ATGTCAGAAATTACGTATAAG pLKO_005 2711 3UTR 100% 13.200 18.480 N Zfp235 n/a
2 TRCN0000086473 CCCTGCAAGTAAGGCTCAAAT pLKO.1 2994 3UTR 100% 13.200 18.480 N Zfp235 n/a
3 TRCN0000086474 GCGCTTCAACTGGAGTTTGAA pLKO.1 1864 CDS 100% 0.563 0.788 N Zfp235 n/a
4 TRCN0000086475 GCAGGTCCTCTTAGGAAATAA pLKO.1 1066 CDS 100% 15.000 12.000 N Zfp235 n/a
5 TRCN0000414496 GAAGCACAGATCTCAACATTC pLKO_005 1371 CDS 100% 10.800 7.560 N Zfp235 n/a
6 TRCN0000434159 GAGTCTCACAAGCGATCATTC pLKO_005 703 CDS 100% 10.800 7.560 N Zfp235 n/a
7 TRCN0000239756 ACAGGAGAGAAGCCATATAAG pLKO_005 1490 CDS 100% 13.200 6.600 Y Gm11677 n/a
8 TRCN0000239755 GTGGGAAGCGCTTCAGCTTAA pLKO_005 1605 CDS 100% 10.800 5.400 Y Gm11677 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.