Transcript: Mouse XM_017322387.1

PREDICTED: Mus musculus WD repeat and FYVE domain containing 1 (Wdfy1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdfy1 (69368)
Length:
2462
CDS:
230..916

Additional Resources:

NCBI RefSeq record:
XM_017322387.1
NBCI Gene record:
Wdfy1 (69368)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322387.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103689 CGGATATTTGTGGGCCAGGAT pLKO.1 473 CDS 100% 2.640 2.112 N Wdfy1 n/a
2 TRCN0000324426 CGGATATTTGTGGGCCAGGAT pLKO_005 473 CDS 100% 2.640 2.112 N Wdfy1 n/a
3 TRCN0000103685 GCTGTGATGGAATTTCACGTT pLKO.1 500 CDS 100% 2.640 2.112 N Wdfy1 n/a
4 TRCN0000324358 GCTGTGATGGAATTTCACGTT pLKO_005 500 CDS 100% 2.640 2.112 N Wdfy1 n/a
5 TRCN0000103686 ACCATCCGAGTATGGCTGAAA pLKO.1 368 CDS 100% 4.950 3.465 N Wdfy1 n/a
6 TRCN0000324428 ACCATCCGAGTATGGCTGAAA pLKO_005 368 CDS 100% 4.950 3.465 N Wdfy1 n/a
7 TRCN0000103687 CCGCGTGTCTGCTATCATCTT pLKO.1 574 CDS 100% 4.950 3.465 N Wdfy1 n/a
8 TRCN0000324356 CCGCGTGTCTGCTATCATCTT pLKO_005 574 CDS 100% 4.950 3.465 N Wdfy1 n/a
9 TRCN0000103688 CCACGACAGCAGGCGGATATT pLKO.1 460 CDS 100% 4.400 3.080 N Wdfy1 n/a
10 TRCN0000353942 CCACGACAGCAGGCGGATATT pLKO_005 460 CDS 100% 4.400 3.080 N Wdfy1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322387.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03833 pDONR223 100% 48.3% 48.5% None (many diffs) n/a
2 ccsbBroad304_03833 pLX_304 0% 48.3% 48.5% V5 (many diffs) n/a
3 TRCN0000466652 AGTTAGTTTTTCAGTAACCATGAG pLX_317 32.4% 48.3% 48.5% V5 (many diffs) n/a
Download CSV