Transcript: Human XM_024446212.1

PREDICTED: Homo sapiens zinc finger DHHC-type containing 11 (ZDHHC11), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZDHHC11 (79844)
Length:
2322
CDS:
101..1339

Additional Resources:

NCBI RefSeq record:
XM_024446212.1
NBCI Gene record:
ZDHHC11 (79844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446212.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231890 TCAGTTCTCCACTCGTGTACA pLKO_005 1201 CDS 100% 4.950 6.930 N ZDHHC11 n/a
2 TRCN0000231888 ACAAGCACTTATGTCACTTCT pLKO_005 1065 CDS 100% 4.950 3.960 N ZDHHC11 n/a
3 TRCN0000232687 GAGTTCACAGTACTCGGAAAT pLKO_005 2053 3UTR 100% 10.800 7.560 N ZDHHC11 n/a
4 TRCN0000231887 CCTGCTGATTCACAAGCACTT pLKO_005 1054 CDS 100% 4.050 2.835 N ZDHHC11 n/a
5 TRCN0000231889 GATGAAGACCCGTGTCCATCT pLKO_005 1130 CDS 100% 4.050 2.835 N ZDHHC11 n/a
6 TRCN0000146918 CCACCTTTGAGTATCTCATTA pLKO.1 900 CDS 100% 13.200 6.600 Y ZDHHC11 n/a
7 TRCN0000147792 GAAAGATCCATACGTGCAAAT pLKO.1 961 CDS 100% 10.800 5.400 Y ZDHHC11 n/a
8 TRCN0000149871 GAAACAACAGAGCCCATGAAA pLKO.1 1292 CDS 100% 5.625 2.813 Y ZDHHC11 n/a
9 TRCN0000130923 CCACCACTGCAAATGGATCAA pLKO.1 556 CDS 100% 4.950 2.475 Y ZDHHC11 n/a
10 TRCN0000127619 CCACTGCAAATGGATCAACAA pLKO.1 559 CDS 100% 4.950 2.475 Y ZDHHC11 n/a
11 TRCN0000148432 CTCCAATGTCAGACTCATGAA pLKO.1 391 CDS 100% 4.950 2.475 Y ZDHHC11 n/a
12 TRCN0000149057 GCCGGAATTATTGGTTCTTCT pLKO.1 591 CDS 100% 4.950 2.475 Y ZDHHC11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446212.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04137 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04137 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465206 GACGAATCAGGCCCTCGAACGTCA pLX_317 13.4% 100% 100% V5 n/a
Download CSV