Transcript: Human XM_024446296.1

PREDICTED: Homo sapiens solute carrier family 17 member 4 (SLC17A4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC17A4 (10050)
Length:
2652
CDS:
130..1623

Additional Resources:

NCBI RefSeq record:
XM_024446296.1
NBCI Gene record:
SLC17A4 (10050)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428901 CCATTAGGGCTATGATCAAAT pLKO_005 980 CDS 100% 13.200 18.480 N SLC17A4 n/a
2 TRCN0000045048 CCTTACGTCTTCTATATCTTT pLKO.1 814 CDS 100% 5.625 7.875 N SLC17A4 n/a
3 TRCN0000434682 AGCATAGGTGTGTTGAGATTT pLKO_005 1817 3UTR 100% 13.200 9.240 N SLC17A4 n/a
4 TRCN0000045051 CAGTATTCAATTTGGGTCAAA pLKO.1 679 CDS 100% 4.950 3.465 N SLC17A4 n/a
5 TRCN0000045050 CCTCATCTTGCAGCTCTGTAA pLKO.1 249 CDS 100% 4.950 3.465 N SLC17A4 n/a
6 TRCN0000045052 CCTTGCCGTTTGTTGTTGGAT pLKO.1 1133 CDS 100% 3.000 2.100 N SLC17A4 n/a
7 TRCN0000101962 CCAACAAATGAACTTGAGCTT pLKO.1 285 CDS 100% 2.640 1.848 N Slc17a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446296.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11450 pDONR223 100% 89% 88.9% None 1_162del;228T>C;1114G>A n/a
2 ccsbBroad304_11450 pLX_304 0% 89% 88.9% V5 1_162del;228T>C;1114G>A n/a
3 TRCN0000467603 GGCGGTGGCGGCGTCTACTCACCC pLX_317 31.1% 89% 88.9% V5 1_162del;228T>C;1114G>A n/a
Download CSV