Transcript: Human XM_024446341.1

PREDICTED: Homo sapiens taxilin beta (TXLNB), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TXLNB (167838)
Length:
5168
CDS:
649..2703

Additional Resources:

NCBI RefSeq record:
XM_024446341.1
NBCI Gene record:
TXLNB (167838)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167865 GCTAAAGAATATGAGTGCTTT pLKO.1 1927 CDS 100% 4.950 3.960 N TXLNB n/a
2 TRCN0000440863 GCAGCAGAGTGAGCGAAATAT pLKO_005 1434 CDS 100% 15.000 10.500 N TXLNB n/a
3 TRCN0000415054 ATGGATGCCCAGGTTACATTT pLKO_005 3113 3UTR 100% 13.200 9.240 N TXLNB n/a
4 TRCN0000168432 GAATGCAGAATCACCTGACAA pLKO.1 918 CDS 100% 4.950 3.465 N TXLNB n/a
5 TRCN0000166966 GCATACAGTTTGTTTGAAGTA pLKO.1 4443 3UTR 100% 4.950 3.465 N TXLNB n/a
6 TRCN0000168721 GCTGAATTGCTGGATGAACAT pLKO.1 1156 CDS 100% 4.950 3.465 N TXLNB n/a
7 TRCN0000167832 GCCTTCATGATAATTCATCAT pLKO.1 2164 CDS 100% 0.495 0.347 N TXLNB n/a
8 TRCN0000172996 CCAAAGAAACCCAACCCGAAA pLKO.1 2207 CDS 100% 4.050 2.430 N TXLNB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446341.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09772 pDONR223 100% 99.8% 99.7% None 1042G>A;1617G>A;1804G>C n/a
2 ccsbBroad304_09772 pLX_304 0% 99.8% 99.7% V5 1042G>A;1617G>A;1804G>C n/a
3 TRCN0000467713 TACATCGTTAATCGCATTCGAACC pLX_317 18.3% 99.8% 99.7% V5 1042G>A;1617G>A;1804G>C n/a
Download CSV