Transcript: Human XM_024446424.1

PREDICTED: Homo sapiens jumonji and AT-rich interaction domain containing 2 (JARID2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
JARID2 (3720)
Length:
5820
CDS:
376..4047

Additional Resources:

NCBI RefSeq record:
XM_024446424.1
NBCI Gene record:
JARID2 (3720)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446424.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296851 CAACGCCCGTGGTCGATTTAT pLKO_005 4054 3UTR 100% 15.000 21.000 N JARID2 n/a
2 TRCN0000296775 TTATCGAACAGCGAGGAATAT pLKO_005 2781 CDS 100% 13.200 18.480 N JARID2 n/a
3 TRCN0000234447 TGACTATTCCCTGGCTAAATA pLKO_005 3041 CDS 100% 15.000 12.000 N Jarid2 n/a
4 TRCN0000358750 TGACTATTCCCTGGCTAAATA pLKO_005 3041 CDS 100% 15.000 12.000 N JARID2 n/a
5 TRCN0000234445 ACTTCCACAAGTGCATCTATA pLKO_005 2732 CDS 100% 13.200 10.560 N Jarid2 n/a
6 TRCN0000358748 ACTTCCACAAGTGCATCTATA pLKO_005 2732 CDS 100% 13.200 10.560 N JARID2 n/a
7 TRCN0000107367 CCACTAGCAACGATGTTAGTT pLKO.1 530 CDS 100% 5.625 4.500 N JARID2 n/a
8 TRCN0000296776 GCCCAACAGCATGGTGTATTT pLKO_005 813 CDS 100% 13.200 9.240 N JARID2 n/a
9 TRCN0000234448 TGTCTTTGCACTAGCTCTAAA pLKO_005 4133 3UTR 100% 13.200 9.240 N Jarid2 n/a
10 TRCN0000107369 GAAACAGGTTTCTAAGGTAAA pLKO.1 1206 CDS 100% 10.800 7.560 N JARID2 n/a
11 TRCN0000291132 GAAACAGGTTTCTAAGGTAAA pLKO_005 1206 CDS 100% 10.800 7.560 N JARID2 n/a
12 TRCN0000107368 CCTCCACTAGCAACGATGTTA pLKO.1 527 CDS 100% 5.625 3.938 N JARID2 n/a
13 TRCN0000096640 CCACCAACAATGCTTCATCTT pLKO.1 899 CDS 100% 4.950 3.465 N Jarid2 n/a
14 TRCN0000107366 CGCTACGATGAGGAACAGATT pLKO.1 3853 CDS 100% 4.950 3.465 N JARID2 n/a
15 TRCN0000096643 GAACCCAAAGTCATGCACTAA pLKO.1 1545 CDS 100% 4.950 3.465 N Jarid2 n/a
16 TRCN0000107365 GCTGCTTACATCACTGAACAA pLKO.1 5321 3UTR 100% 4.950 3.465 N JARID2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446424.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.