Transcript: Human XM_024446434.1

PREDICTED: Homo sapiens thymocyte selection associated (THEMIS), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THEMIS (387357)
Length:
4209
CDS:
784..2418

Additional Resources:

NCBI RefSeq record:
XM_024446434.1
NBCI Gene record:
THEMIS (387357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128729 CGAGTGTGAAGATGAACGTAT pLKO.1 1014 CDS 100% 4.950 6.930 N THEMIS n/a
2 TRCN0000130264 CCCATAGTGACTGAAGTCATA pLKO.1 1336 CDS 100% 4.950 3.960 N THEMIS n/a
3 TRCN0000128476 GAGATCACTGAAGAGCAATAT pLKO.1 2092 CDS 100% 13.200 9.240 N THEMIS n/a
4 TRCN0000129765 CACTGATTCTTACGATGCTAA pLKO.1 1257 CDS 100% 4.950 3.465 N THEMIS n/a
5 TRCN0000129023 GCTCAACTCAGTTGAAGAGAT pLKO.1 903 CDS 100% 4.950 3.465 N THEMIS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10084 pDONR223 100% 84.8% 84.7% None 0_1ins291;1597A>G n/a
2 ccsbBroad304_10084 pLX_304 0% 84.8% 84.7% V5 0_1ins291;1597A>G n/a
3 TRCN0000473800 TACACACATGGTCTCATTTGATAA pLX_317 17.5% 84.8% 84.7% V5 0_1ins291;1597A>G n/a
Download CSV