Transcript: Human XM_024446452.1

PREDICTED: Homo sapiens cytochrome P450 family 39 subfamily A member 1 (CYP39A1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYP39A1 (51302)
Length:
3159
CDS:
103..1314

Additional Resources:

NCBI RefSeq record:
XM_024446452.1
NBCI Gene record:
CYP39A1 (51302)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064444 CGTTTATCGTACAGCATCAAT pLKO.1 198 CDS 100% 5.625 7.875 N CYP39A1 n/a
2 TRCN0000064445 CCTGGAGAATCTCCTTCTAAT pLKO.1 861 CDS 100% 13.200 9.240 N CYP39A1 n/a
3 TRCN0000435918 TTGCAAGCTACGCTGGATATT pLKO_005 637 CDS 100% 13.200 9.240 N CYP39A1 n/a
4 TRCN0000064443 CCTGAATTGTTCAAACCTGAA pLKO.1 1042 CDS 100% 4.050 2.835 N CYP39A1 n/a
5 TRCN0000064446 GCACTCTTTCTTGGACTGCTT pLKO.1 1089 CDS 100% 2.640 1.848 N CYP39A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08273 pDONR223 100% 76.4% 72.6% None (many diffs) n/a
2 ccsbBroad304_08273 pLX_304 0% 76.4% 72.6% V5 (many diffs) n/a
3 TRCN0000479197 CCCCTTCGGAAAGTGATGACCTTG pLX_317 29% 76.4% 72.6% V5 (many diffs) n/a
Download CSV