Transcript: Human XM_024446628.1

PREDICTED: Homo sapiens actin related protein 2/3 complex subunit 1B (ARPC1B), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARPC1B (10095)
Length:
1773
CDS:
339..1457

Additional Resources:

NCBI RefSeq record:
XM_024446628.1
NBCI Gene record:
ARPC1B (10095)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379761 GACTTCAAGTGTCGGATCTTT pLKO_005 825 CDS 100% 5.625 7.875 N ARPC1B n/a
2 TRCN0000036495 GCTGGGTACATGGCGTCTGTT pLKO.1 946 CDS 100% 1.650 2.310 N ARPC1B n/a
3 TRCN0000333046 GCTGGGTACATGGCGTCTGTT pLKO_005 946 CDS 100% 1.650 2.310 N ARPC1B n/a
4 TRCN0000380468 CAAATGACCTGTGAGGAATAT pLKO_005 1451 CDS 100% 13.200 9.240 N ARPC1B n/a
5 TRCN0000353077 ATGGATGGCGGCATGAGTATC pLKO_005 1386 CDS 100% 10.800 7.560 N ARPC1B n/a
6 TRCN0000379578 GAGGAATATGTTGCCTTCATC pLKO_005 1463 3UTR 100% 4.950 3.465 N ARPC1B n/a
7 TRCN0000036494 GCTGACCTTCATCACAGACAA pLKO.1 1085 CDS 100% 4.950 3.465 N ARPC1B n/a
8 TRCN0000333114 GCTGACCTTCATCACAGACAA pLKO_005 1085 CDS 100% 4.950 3.465 N ARPC1B n/a
9 TRCN0000036496 CCCAACGAGAACAAGTTTGCT pLKO.1 654 CDS 100% 3.000 2.100 N ARPC1B n/a
10 TRCN0000036498 CAAGCACATCAAGAAGCCCAT pLKO.1 740 CDS 100% 2.160 1.512 N ARPC1B n/a
11 TRCN0000381415 TGTTGCCTTCATCCTAGCTGC pLKO_005 1471 3UTR 100% 2.160 1.512 N ARPC1B n/a
12 TRCN0000036497 CATGAGGTGCATATCTATGAA pLKO.1 426 CDS 100% 5.625 3.375 N ARPC1B n/a
13 TRCN0000333113 CATGAGGTGCATATCTATGAA pLKO_005 426 CDS 100% 5.625 3.375 N ARPC1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02312 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02312 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473738 CGAGTGATCCCACTACCCTTACCG pLX_317 39.7% 100% 100% V5 n/a
Download CSV