Transcript: Human XM_024446697.1

PREDICTED: Homo sapiens potassium sodium-activated channel subfamily T member 2 (KCNT2), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNT2 (343450)
Length:
5231
CDS:
801..2792

Additional Resources:

NCBI RefSeq record:
XM_024446697.1
NBCI Gene record:
KCNT2 (343450)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446697.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265357 ATTGGATAACCCGCCAGATAT pLKO_005 1628 CDS 100% 13.200 18.480 N Kcnt2 n/a
2 TRCN0000056253 CCCTTAAAGATCAAGACCTAT pLKO.1 563 5UTR 100% 4.950 6.930 N KCNT2 n/a
3 TRCN0000056255 CCTTTATGTTTCGACTGCCTT pLKO.1 1987 CDS 100% 2.640 3.696 N KCNT2 n/a
4 TRCN0000056256 GCTAAAGGTTACCCACCTTAT pLKO.1 1365 CDS 100% 1.080 1.512 N KCNT2 n/a
5 TRCN0000056254 CCAGGATTATTATGTGGTGAT pLKO.1 453 5UTR 100% 4.050 3.240 N KCNT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446697.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13606 pDONR223 100% 55.2% 55.3% None (many diffs) n/a
2 ccsbBroad304_13606 pLX_304 0% 55.2% 55.3% V5 (many diffs) n/a
Download CSV