Transcript: Human XM_024446766.1

PREDICTED: Homo sapiens muskelin 1 (MKLN1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MKLN1 (4289)
Length:
11166
CDS:
328..2259

Additional Resources:

NCBI RefSeq record:
XM_024446766.1
NBCI Gene record:
MKLN1 (4289)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446766.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116858 CCAGCGATCAAAGACCTATTT pLKO.1 1476 CDS 100% 13.200 18.480 N MKLN1 n/a
2 TRCN0000116860 GCTGGTGTTGAAGGGTGATTT pLKO.1 696 CDS 100% 13.200 9.240 N MKLN1 n/a
3 TRCN0000310420 GCTGGTGTTGAAGGGTGATTT pLKO_005 696 CDS 100% 13.200 9.240 N MKLN1 n/a
4 TRCN0000116859 GCCAGCGATCAAAGACCTATT pLKO.1 1475 CDS 100% 10.800 7.560 N MKLN1 n/a
5 TRCN0000299216 GCCAGCGATCAAAGACCTATT pLKO_005 1475 CDS 100% 10.800 7.560 N MKLN1 n/a
6 TRCN0000116861 GCACTGGAACATCCCATGTTA pLKO.1 658 CDS 100% 5.625 3.938 N MKLN1 n/a
7 TRCN0000299218 GCACTGGAACATCCCATGTTA pLKO_005 658 CDS 100% 5.625 3.938 N MKLN1 n/a
8 TRCN0000116857 GCCTCAAATAATACCAAGTTA pLKO.1 8961 3UTR 100% 5.625 3.938 N MKLN1 n/a
9 TRCN0000299217 GCCTCAAATAATACCAAGTTA pLKO_005 8961 3UTR 100% 5.625 3.938 N MKLN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446766.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06584 pDONR223 100% 87.3% 87.4% None 0_1ins276;1048C>A;1299T>C n/a
2 ccsbBroad304_06584 pLX_304 0% 87.3% 87.4% V5 0_1ins276;1048C>A;1299T>C n/a
Download CSV