Transcript: Human XM_024446802.1

PREDICTED: Homo sapiens DNA polymerase delta 2, accessory subunit (POLD2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POLD2 (5425)
Length:
1692
CDS:
185..1594

Additional Resources:

NCBI RefSeq record:
XM_024446802.1
NBCI Gene record:
POLD2 (5425)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052967 CCCACTTGACACAGATAGGTT pLKO.1 748 CDS 100% 3.000 4.200 N POLD2 n/a
2 TRCN0000298739 CCCACTTGACACAGATAGGTT pLKO_005 748 CDS 100% 3.000 4.200 N POLD2 n/a
3 TRCN0000052965 CGAGTTTGATCCCACCAATTA pLKO.1 1075 CDS 100% 13.200 9.240 N POLD2 n/a
4 TRCN0000310322 CGAGTTTGATCCCACCAATTA pLKO_005 1075 CDS 100% 13.200 9.240 N POLD2 n/a
5 TRCN0000052966 GCCAAATACCTCACCAAGAAA pLKO.1 965 CDS 100% 5.625 3.938 N POLD2 n/a
6 TRCN0000298741 GCCAAATACCTCACCAAGAAA pLKO_005 965 CDS 100% 5.625 3.938 N POLD2 n/a
7 TRCN0000052963 CCACCATTGATGGAGTCAGAT pLKO.1 1185 CDS 100% 4.950 3.465 N POLD2 n/a
8 TRCN0000298740 CCACCATTGATGGAGTCAGAT pLKO_005 1185 CDS 100% 4.950 3.465 N POLD2 n/a
9 TRCN0000052964 CCTCATCCAAATGAGACCCTT pLKO.1 355 CDS 100% 0.264 0.185 N POLD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01235 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01235 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469533 CATTACTTTGGGCCGGGTCCTCCG pLX_317 31.8% 100% 100% V5 n/a
Download CSV