Transcript: Human XM_024446821.1

PREDICTED: Homo sapiens transmembrane protein 248 (TMEM248), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM248 (55069)
Length:
2261
CDS:
269..1213

Additional Resources:

NCBI RefSeq record:
XM_024446821.1
NBCI Gene record:
TMEM248 (55069)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167131 CAATCCTTTCTGGTGTTATAA pLKO.1 967 CDS 100% 15.000 21.000 N TMEM248 n/a
2 TRCN0000263728 CAATCCTTTCTGGTGTTATAA pLKO_005 967 CDS 100% 15.000 21.000 N TMEM248 n/a
3 TRCN0000267822 CAATCCTTTCTGGTGTTATAA pLKO_005 967 CDS 100% 15.000 21.000 N Tmem248 n/a
4 TRCN0000263726 CCAGATGATGACCGTTCATTA pLKO_005 1043 CDS 100% 13.200 18.480 N TMEM248 n/a
5 TRCN0000166979 CCCAATATGTAGAGAACATTT pLKO.1 1600 3UTR 100% 13.200 9.240 N TMEM248 n/a
6 TRCN0000263727 GCTTTGGCTGAAGCCTAATTC pLKO_005 1196 CDS 100% 13.200 9.240 N TMEM248 n/a
7 TRCN0000282786 TCAAGGGCAGACCTAGCAAAT pLKO_005 1137 CDS 100% 10.800 7.560 N TMEM248 n/a
8 TRCN0000172530 GCATCTCATGCACACCAGTTA pLKO.1 1072 CDS 100% 4.950 3.465 N TMEM248 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446821.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03514 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03514 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471643 ACTGAGCAAGTCCCCCTTCCTATA pLX_317 52.1% 100% 100% V5 n/a
Download CSV