Transcript: Human XM_024446968.1

PREDICTED: Homo sapiens ubiquitin specific peptidase 42 (USP42), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP42 (84132)
Length:
5706
CDS:
754..4737

Additional Resources:

NCBI RefSeq record:
XM_024446968.1
NBCI Gene record:
USP42 (84132)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350776 CTTGATATTCGGCCATATATG pLKO_005 1765 CDS 100% 13.200 18.480 N USP42 n/a
2 TRCN0000336945 TGACCCTAAACGGTGCTAATA pLKO_005 2717 CDS 100% 13.200 18.480 N USP42 n/a
3 TRCN0000336946 ATCAATGAGATGCGGCGTATA pLKO_005 1291 CDS 100% 10.800 15.120 N USP42 n/a
4 TRCN0000155621 CGAAACACTTACGGATGGAAA pLKO.1 4637 CDS 100% 4.950 6.930 N USP42 n/a
5 TRCN0000156179 CGAGTTCATCTGTACCTGATA pLKO.1 944 CDS 100% 4.950 6.930 N USP42 n/a
6 TRCN0000336944 CGAGTTCATCTGTACCTGATA pLKO_005 944 CDS 100% 4.950 6.930 N USP42 n/a
7 TRCN0000156590 GATCGGTTTCACGAACACGAA pLKO.1 4198 CDS 100% 2.640 3.696 N USP42 n/a
8 TRCN0000350777 CATCTCAAATGCTGCTTAATT pLKO_005 4946 3UTR 100% 15.000 10.500 N USP42 n/a
9 TRCN0000154891 CGTCTCTTGTCTTCACTGATA pLKO.1 5366 3UTR 100% 4.950 3.465 N USP42 n/a
10 TRCN0000155673 CGTGATGAATGGCAAATCCAA pLKO.1 2526 CDS 100% 3.000 2.100 N USP42 n/a
11 TRCN0000156772 GCAAGGAGAATGGGATTGGTA pLKO.1 2621 CDS 100% 3.000 2.100 N USP42 n/a
12 TRCN0000156541 GCGTCTCTTGTCTTCACTGAT pLKO.1 5365 3UTR 100% 4.950 2.970 N USP42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04333 pDONR223 100% 99% 99% None 3942_3943insGGT;3946_3981del n/a
2 ccsbBroad304_04333 pLX_304 0% 99% 99% V5 3942_3943insGGT;3946_3981del n/a
3 TRCN0000477910 TTTACTCAGAAGTACATTCGAGGT pLX_317 12.8% 99% 99% V5 3942_3943insGGT;3946_3981del n/a
Download CSV