Transcript: Human XM_024447078.1

PREDICTED: Homo sapiens minichromosome maintenance domain containing 2 (MCMDC2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCMDC2 (157777)
Length:
5074
CDS:
710..2029

Additional Resources:

NCBI RefSeq record:
XM_024447078.1
NBCI Gene record:
MCMDC2 (157777)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447078.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149391 GCTTTATAGGAGACTTGGCTT pLKO.1 1206 CDS 100% 2.640 3.696 N MCMDC2 n/a
2 TRCN0000419296 CAAGTGATACTCTACTCATAG pLKO_005 1032 CDS 100% 10.800 8.640 N MCMDC2 n/a
3 TRCN0000413261 AGAATGACCCATGGCTATTAT pLKO_005 1661 CDS 100% 15.000 10.500 N MCMDC2 n/a
4 TRCN0000435285 CTAATTGCTAATGGGATAAAT pLKO_005 2184 3UTR 100% 15.000 10.500 N MCMDC2 n/a
5 TRCN0000150099 CTCTGTTTGTTGATGAGTCTA pLKO.1 953 CDS 100% 4.950 3.465 N MCMDC2 n/a
6 TRCN0000149097 GCTGAGCTTGGAAATCACATT pLKO.1 275 5UTR 100% 4.950 3.465 N MCMDC2 n/a
7 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3265 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447078.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13302 pDONR223 100% 51.4% 51.4% None 0_1ins711;1044_1317delinsG n/a
2 ccsbBroad304_13302 pLX_304 0% 51.4% 51.4% V5 0_1ins711;1044_1317delinsG n/a
3 TRCN0000472583 ACAAATATGGCAACAGGTCCCGTA pLX_317 22.4% 51.4% 51.4% V5 0_1ins711;1044_1317delinsG n/a
Download CSV