Transcript: Human XM_024447082.1

PREDICTED: Homo sapiens cyclic nucleotide binding domain containing 1 (CNBD1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNBD1 (168975)
Length:
1007
CDS:
55..987

Additional Resources:

NCBI RefSeq record:
XM_024447082.1
NBCI Gene record:
CNBD1 (168975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016173 CCGGAGTATGAGCAATATCTT pLKO.1 213 CDS 100% 5.625 7.875 N CNBD1 n/a
2 TRCN0000016176 GCACATTAATTATGGCCAGTT pLKO.1 159 CDS 100% 4.050 3.240 N CNBD1 n/a
3 TRCN0000016174 CCTCAAACAAACGTGTATAAA pLKO.1 679 CDS 100% 15.000 10.500 N CNBD1 n/a
4 TRCN0000420412 GTCTCACATGACAGCTATTAA pLKO_005 87 CDS 100% 15.000 10.500 N CNBD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05147 pDONR223 100% 64.5% 60.9% None (many diffs) n/a
2 ccsbBroad304_05147 pLX_304 0% 64.5% 60.9% V5 (many diffs) n/a
3 TRCN0000468954 AACCGTGGCGAAGCCTACCCTAAC pLX_317 29.6% 64.5% 60.9% V5 (many diffs) n/a
Download CSV