Transcript: Human XM_024447096.1

PREDICTED: Homo sapiens exostosin like glycosyltransferase 3 (EXTL3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXTL3 (2137)
Length:
6173
CDS:
593..3352

Additional Resources:

NCBI RefSeq record:
XM_024447096.1
NBCI Gene record:
EXTL3 (2137)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323008 TCGTGTTACCGAGGTTCATTT pLKO_005 2056 CDS 100% 13.200 18.480 N EXTL3 n/a
2 TRCN0000141766 GCGGAAATATCTCTTCACCTT pLKO.1 1606 CDS 100% 2.640 3.696 N EXTL3 n/a
3 TRCN0000323005 GCGGAAATATCTCTTCACCTT pLKO_005 1606 CDS 100% 2.640 3.696 N EXTL3 n/a
4 TRCN0000144207 CATGGTGGATGAATACATCAA pLKO.1 3061 CDS 100% 4.950 3.960 N EXTL3 n/a
5 TRCN0000093748 GCCTTCTTTCACAAGTATTAT pLKO.1 2999 CDS 100% 15.000 10.500 N Extl3 n/a
6 TRCN0000323009 TTGCCATTCAAGGCTTATTTA pLKO_005 3715 3UTR 100% 15.000 10.500 N EXTL3 n/a
7 TRCN0000144948 GCTACACAACTGCTTTGATTA pLKO.1 1126 CDS 100% 13.200 9.240 N EXTL3 n/a
8 TRCN0000144438 CAGTTTGAACAACCGATTCTT pLKO.1 2761 CDS 100% 5.625 3.938 N EXTL3 n/a
9 TRCN0000141559 CAAGACCAAGTGCTTCAAGTT pLKO.1 3325 CDS 100% 4.950 3.465 N EXTL3 n/a
10 TRCN0000323007 CAAGACCAAGTGCTTCAAGTT pLKO_005 3325 CDS 100% 4.950 3.465 N EXTL3 n/a
11 TRCN0000141339 CCGTACTGAGAAGAACAGTTT pLKO.1 2746 CDS 100% 4.950 3.465 N EXTL3 n/a
12 TRCN0000323006 CCGTACTGAGAAGAACAGTTT pLKO_005 2746 CDS 100% 4.950 3.465 N EXTL3 n/a
13 TRCN0000140471 GCATTCCTACAAGGAGCTCAT pLKO.1 1009 CDS 100% 4.050 2.835 N EXTL3 n/a
14 TRCN0000142093 GCTGCCTTCTTTCACAAGTAT pLKO.1 2996 CDS 100% 5.625 3.375 N EXTL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06184 pDONR223 100% 99.9% 100% None 1227G>A n/a
2 ccsbBroad304_06184 pLX_304 0% 99.9% 100% V5 1227G>A n/a
3 TRCN0000467474 TTCATCGATCGAAAAAAATAGAAC pLX_317 4.3% 99.9% 100% V5 1227G>A n/a
Download CSV