Transcript: Human XM_024447162.1

PREDICTED: Homo sapiens methionine sulfoxide reductase A (MSRA), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MSRA (4482)
Length:
850
CDS:
294..671

Additional Resources:

NCBI RefSeq record:
XM_024447162.1
NBCI Gene record:
MSRA (4482)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046453 GCGGCCAAACATCATGTCAAT pLKO.1 432 CDS 100% 4.950 6.930 N MSRA n/a
2 TRCN0000046455 GCAACAGAACAGTCGAACCTT pLKO.1 454 CDS 100% 3.000 4.200 N MSRA n/a
3 TRCN0000286336 GCAACAGAACAGTCGAACCTT pLKO_005 454 CDS 100% 3.000 4.200 N MSRA n/a
4 TRCN0000046457 TGGGTCTTGAAAGGAGTGTAT pLKO.1 540 CDS 100% 4.950 3.465 N MSRA n/a
5 TRCN0000286327 TGGGTCTTGAAAGGAGTGTAT pLKO_005 540 CDS 100% 4.950 3.465 N MSRA n/a
6 TRCN0000046454 GCAGGAGGCTATACTTCAAAT pLKO.1 579 CDS 100% 13.200 7.920 N MSRA n/a
7 TRCN0000298176 GCAGGAGGCTATACTTCAAAT pLKO_005 579 CDS 100% 13.200 7.920 N MSRA n/a
8 TRCN0000042095 CTGGGTCTTGAAAGGAGTGTA pLKO.1 539 CDS 100% 4.950 2.970 N Msra n/a
9 TRCN0000334723 CTGGGTCTTGAAAGGAGTGTA pLKO_005 539 CDS 100% 4.950 2.970 N Msra n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01038 pDONR223 100% 50.8% 48.5% None (many diffs) n/a
2 ccsbBroad304_01038 pLX_304 0% 50.8% 48.5% V5 (many diffs) n/a
3 TRCN0000480533 TGCGCTCTCTAGAGGGTAGACACG pLX_317 51.7% 50.8% 48.5% V5 (many diffs) n/a
Download CSV