Transcript: Human XM_024447165.1

PREDICTED: Homo sapiens nibrin (NBN), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NBN (4683)
Length:
4548
CDS:
1065..2450

Additional Resources:

NCBI RefSeq record:
XM_024447165.1
NBCI Gene record:
NBN (4683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040134 GCCGAAATCATGCTGTGTTAA pLKO.1 220 5UTR 100% 13.200 18.480 N NBN n/a
2 TRCN0000040135 GCTCGAAAGAATACAGAACTA pLKO.1 2322 CDS 100% 4.950 3.960 N NBN n/a
3 TRCN0000306976 GCTCGAAAGAATACAGAACTA pLKO_005 2322 CDS 100% 4.950 3.960 N NBN n/a
4 TRCN0000295898 CCATCCCAGTACAGGATTAAA pLKO_005 1166 CDS 100% 15.000 10.500 N NBN n/a
5 TRCN0000040137 CCTCTTGATGAACCATCTATT pLKO.1 780 5UTR 100% 13.200 9.240 N NBN n/a
6 TRCN0000288632 CCTCTTGATGAACCATCTATT pLKO_005 780 5UTR 100% 13.200 9.240 N NBN n/a
7 TRCN0000040136 GCAAGCAGATACATGGGATTT pLKO.1 1295 CDS 100% 10.800 7.560 N NBN n/a
8 TRCN0000288622 GCAAGCAGATACATGGGATTT pLKO_005 1295 CDS 100% 10.800 7.560 N NBN n/a
9 TRCN0000040133 GCTTATTTAGAGTCCTAGTTT pLKO.1 3182 3UTR 100% 5.625 3.938 N NBN n/a
10 TRCN0000288623 GCTTATTTAGAGTCCTAGTTT pLKO_005 3182 3UTR 100% 5.625 3.938 N NBN n/a
11 TRCN0000010392 CAAGCTATATTGCAACTTGGA pLKO.1 483 5UTR 100% 2.640 1.848 N NBN n/a
12 TRCN0000010393 GAAGAGTGGCTAAGGCAGGAA pLKO.1 2343 CDS 100% 2.640 1.584 N NBN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06618 pDONR223 100% 61% 61% None (many diffs) n/a
2 ccsbBroad304_06618 pLX_304 0% 61% 61% V5 (many diffs) n/a
3 TRCN0000478658 CACTATGAGGAGATTCAAACCTTA pLX_317 18% 61% 61% V5 (many diffs) n/a
Download CSV