Transcript: Human XM_024447275.1

PREDICTED: Homo sapiens zinc finger matrin-type 4 (ZMAT4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZMAT4 (79698)
Length:
3271
CDS:
437..1021

Additional Resources:

NCBI RefSeq record:
XM_024447275.1
NBCI Gene record:
ZMAT4 (79698)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447275.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440217 GGTCGCATCTCCCTATCAAAG pLKO_005 697 CDS 100% 10.800 15.120 N ZMAT4 n/a
2 TRCN0000157226 GCAAGCAAAGTCCGACTGTAT pLKO.1 413 5UTR 100% 4.950 6.930 N ZMAT4 n/a
3 TRCN0000158376 CCGATTCCCATTATCAAGGCA pLKO.1 567 CDS 100% 0.750 1.050 N ZMAT4 n/a
4 TRCN0000157571 GAATGCGGCAAGAGTTGCTTT pLKO.1 811 CDS 100% 4.950 3.960 N ZMAT4 n/a
5 TRCN0000157526 GCGGCAAGAGTTGCTTTGTTA pLKO.1 815 CDS 100% 5.625 3.938 N ZMAT4 n/a
6 TRCN0000155438 CGATTCCCATTATCAAGGCAA pLKO.1 568 CDS 100% 2.640 1.848 N ZMAT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447275.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08947 pDONR223 100% 38.7% 33.6% None (many diffs) n/a
2 ccsbBroad304_08947 pLX_304 0% 38.7% 33.6% V5 (many diffs) n/a
3 TRCN0000465243 CTTGCTTCCATTTGGCCACTCGGC pLX_317 24.6% 38.7% 33.6% V5 (many diffs) n/a
Download CSV