Transcript: Human XM_024447277.1

PREDICTED: Homo sapiens zinc finger matrin-type 4 (ZMAT4), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZMAT4 (79698)
Length:
10387
CDS:
379..930

Additional Resources:

NCBI RefSeq record:
XM_024447277.1
NBCI Gene record:
ZMAT4 (79698)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447277.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440217 GGTCGCATCTCCCTATCAAAG pLKO_005 639 CDS 100% 10.800 15.120 N ZMAT4 n/a
2 TRCN0000157226 GCAAGCAAAGTCCGACTGTAT pLKO.1 355 5UTR 100% 4.950 6.930 N ZMAT4 n/a
3 TRCN0000158376 CCGATTCCCATTATCAAGGCA pLKO.1 509 CDS 100% 0.750 1.050 N ZMAT4 n/a
4 TRCN0000430324 GAACTGGAACAGATCACTATT pLKO_005 1391 3UTR 100% 13.200 10.560 N ZMAT4 n/a
5 TRCN0000157571 GAATGCGGCAAGAGTTGCTTT pLKO.1 753 CDS 100% 4.950 3.960 N ZMAT4 n/a
6 TRCN0000422140 AGATTTCCTCAGAGCATAATT pLKO_005 1270 3UTR 100% 15.000 10.500 N ZMAT4 n/a
7 TRCN0000446836 GAGAGGTCTGAGGCGCAATTA pLKO_005 813 CDS 100% 13.200 9.240 N ZMAT4 n/a
8 TRCN0000155789 CCGTGGAGAATTGCTTATCAA pLKO.1 978 3UTR 100% 5.625 3.938 N ZMAT4 n/a
9 TRCN0000157526 GCGGCAAGAGTTGCTTTGTTA pLKO.1 757 CDS 100% 5.625 3.938 N ZMAT4 n/a
10 TRCN0000155438 CGATTCCCATTATCAAGGCAA pLKO.1 510 CDS 100% 2.640 1.848 N ZMAT4 n/a
11 TRCN0000154412 GCCTGCATGATGATCTTCTTA pLKO.1 1627 3UTR 100% 5.625 3.375 N ZMAT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447277.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08947 pDONR223 100% 46.5% 46.2% None 0_1ins138;210_437del;463A>G n/a
2 ccsbBroad304_08947 pLX_304 0% 46.5% 46.2% V5 0_1ins138;210_437del;463A>G n/a
3 TRCN0000465243 CTTGCTTCCATTTGGCCACTCGGC pLX_317 24.6% 46.4% 45.8% V5 (many diffs) n/a
Download CSV