Transcript: Human XM_024447292.1

PREDICTED: Homo sapiens family with sequence similarity 167 member A (FAM167A), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM167A (83648)
Length:
4301
CDS:
749..1393

Additional Resources:

NCBI RefSeq record:
XM_024447292.1
NBCI Gene record:
FAM167A (83648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072670 CAAGCTTATTGGCGTGACCAA pLKO.1 1336 CDS 100% 2.640 3.696 N FAM167A n/a
2 TRCN0000072672 GAACATCAACTCTCGGAGGTT pLKO.1 1360 CDS 100% 2.640 3.696 N FAM167A n/a
3 TRCN0000072668 CCTCTAAGTATTGTCTCAAAT pLKO.1 1847 3UTR 100% 13.200 9.240 N FAM167A n/a
4 TRCN0000072671 TGGCGACATCAACAAGCTGAA pLKO.1 1183 CDS 100% 4.050 2.835 N FAM167A n/a
5 TRCN0000072669 GAAGGCTTTCAGAGCATCGAT pLKO.1 1079 CDS 100% 3.000 2.100 N FAM167A n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3362 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09103 pDONR223 100% 99.8% 99.5% None 168T>G n/a
2 ccsbBroad304_09103 pLX_304 0% 99.8% 99.5% V5 168T>G n/a
3 TRCN0000467090 TTTGCATTTCGGACCAAGTGCCTA pLX_317 56.3% 99.8% 99.5% V5 168T>G n/a
Download CSV