Transcript: Human XM_024447356.1

PREDICTED: Homo sapiens nuclear transcription factor Y subunit gamma (NFYC), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NFYC (4802)
Length:
2194
CDS:
202..1419

Additional Resources:

NCBI RefSeq record:
XM_024447356.1
NBCI Gene record:
NFYC (4802)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447356.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274070 ATGATATCGCCATGGCAATTA pLKO_005 707 CDS 100% 13.200 18.480 N NFYC n/a
2 TRCN0000014984 CCACCAATGCTCAACAGATTA pLKO.1 1223 CDS 100% 13.200 18.480 N NFYC n/a
3 TRCN0000274071 CGAGCCAGTCCAGTACTATTT pLKO_005 828 CDS 100% 13.200 9.240 N NFYC n/a
4 TRCN0000014983 CCTCAGATGGAATTAGGTGAA pLKO.1 1873 3UTR 100% 4.050 2.835 N NFYC n/a
5 TRCN0000274069 CCTCAGATGGAATTAGGTGAA pLKO_005 1873 3UTR 100% 4.050 2.835 N NFYC n/a
6 TRCN0000274131 TGGAAGAAATCCGGAATTTAA pLKO_005 491 CDS 100% 15.000 9.000 N NFYC n/a
7 TRCN0000014986 CATCACTAACACAGGAGAGAT pLKO.1 1098 CDS 100% 4.950 2.970 N NFYC n/a
8 TRCN0000014985 GCCTGGATTCACACAGAAGAT pLKO.1 661 CDS 100% 4.950 2.970 N NFYC n/a
9 TRCN0000274072 GCCTGGATTCACACAGAAGAT pLKO_005 661 CDS 100% 4.950 2.970 N NFYC n/a
10 TRCN0000014987 CTGGCTCGTATTAAGAAGATT pLKO.1 544 CDS 100% 5.625 2.813 Y NFYC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447356.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01095 pDONR223 100% 82.7% 82.7% None 1_210del n/a
2 ccsbBroad304_01095 pLX_304 0% 82.7% 82.7% V5 1_210del n/a
3 TRCN0000476529 AACATTTTGATGATTCGGTTACGC pLX_317 38.9% 82.7% 82.7% V5 1_210del n/a
Download CSV