Transcript: Human XM_024447379.1

PREDICTED: Homo sapiens serine palmitoyltransferase long chain base subunit 1 (SPTLC1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPTLC1 (10558)
Length:
2531
CDS:
251..1207

Additional Resources:

NCBI RefSeq record:
XM_024447379.1
NBCI Gene record:
SPTLC1 (10558)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447379.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303770 CGTAGTGACATTAAGTTATTT pLKO_005 392 CDS 100% 15.000 21.000 N SPTLC1 n/a
2 TRCN0000303768 CTCCTTAACTCCTTAGTATTT pLKO_005 1587 3UTR 100% 13.200 18.480 N SPTLC1 n/a
3 TRCN0000035009 CGGCGTTTCATTGTAGTAGAA pLKO.1 500 CDS 100% 4.950 6.930 N SPTLC1 n/a
4 TRCN0000303825 GCTATTCCTGCTTACTCTAAA pLKO_005 305 CDS 100% 13.200 9.240 N SPTLC1 n/a
5 TRCN0000035010 GCCAACATGGAGAATGCACTT pLKO.1 698 CDS 100% 4.050 2.835 N SPTLC1 n/a
6 TRCN0000035012 GCATGAACAGAAGTATTGCAT pLKO.1 1041 CDS 100% 3.000 2.100 N SPTLC1 n/a
7 TRCN0000299784 GCATGAACAGAAGTATTGCAT pLKO_005 1041 CDS 100% 3.000 2.100 N SPTLC1 n/a
8 TRCN0000035011 GCCTGCTTTGCTATTCAGAAA pLKO.1 356 CDS 100% 4.950 2.970 N SPTLC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447379.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11522 pDONR223 100% 58.6% 56.9% None (many diffs) n/a
2 ccsbBroad304_11522 pLX_304 0% 58.6% 56.9% V5 (many diffs) n/a
3 TRCN0000492268 TCTTTGGCAGCTGACGATCTCACA pLX_317 23.9% 58.6% 56.9% V5 (many diffs) n/a
Download CSV