Construct: ORF TRCN0000492268
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018229.1_s317c1
- Derived from:
- ccsbBroadEn_11522
- DNA Barcode:
- TCTTTGGCAGCTGACGATCTCACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPTLC1 (10558)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492268
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10558 | SPTLC1 | serine palmitoyltransferase... | NM_001281303.2 | 99.9% | 99.8% | 1283A>G |
| 2 | human | 10558 | SPTLC1 | serine palmitoyltransferase... | NM_006415.4 | 88.2% | 87% | 1283A>G;1326_1357del;1419_1420ins152 |
| 3 | human | 10558 | SPTLC1 | serine palmitoyltransferase... | XM_011518138.2 | 70.1% | 70.1% | (many diffs) |
| 4 | human | 10558 | SPTLC1 | serine palmitoyltransferase... | NM_001368272.1 | 64.1% | 58% | (many diffs) |
| 5 | human | 10558 | SPTLC1 | serine palmitoyltransferase... | XM_017014201.2 | 64.1% | 58% | (many diffs) |
| 6 | human | 10558 | SPTLC1 | serine palmitoyltransferase... | NM_001368273.1 | 58.6% | 56.9% | (many diffs) |
| 7 | human | 10558 | SPTLC1 | serine palmitoyltransferase... | XM_024447378.1 | 58.6% | 56.9% | (many diffs) |
| 8 | human | 10558 | SPTLC1 | serine palmitoyltransferase... | XM_024447379.1 | 58.6% | 56.9% | (many diffs) |
| 9 | human | 10558 | SPTLC1 | serine palmitoyltransferase... | NM_178324.3 | 27.8% | 27.6% | 429_429delAins1111 |
| 10 | mouse | 268656 | Sptlc1 | serine palmitoyltransferase... | NM_009269.2 | 74.7% | 79.2% | (many diffs) |
| 11 | mouse | 268656 | Sptlc1 | serine palmitoyltransferase... | XM_006516927.1 | 44.5% | 47.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1605
- ORF length:
- 1539
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gaccgccacg gagcagtggg ttctggtgga gatggtacag gcgctttacg 121 aggctcctgc ttaccatctt attttggaag ggattctgat cctctggata atcagacttc 181 ttttctctaa gacttacaaa ttacaagaac gatctgatct tacagtcaag gaaaaagaag 241 aactgattga agagtggcaa ccagaacctc ttgttcctcc tgtcccaaaa gaccatcctg 301 ctctcaacta caacatcgtt tcaggccctc caagccacaa aactgtggtg aatggaaaag 361 aatgtataaa cttcgcctca tttaattttc ttggattgtt ggataaccct agggttaagg 421 cagcagcttt agcatctcta aagaagtatg gcgtggggac ttgtggaccc agaggatttt 481 atggcacatt tgatgttcat ttggatttgg aagaccgcct ggcaaaattt atgaagacag 541 aagaagccat tatatactca tatggatttg ccaccatagc cagtgctatt cctgcttact 601 ctaaaagagg ggacattgtt tttgtagata gagctgcctg ctttgctatt cagaaaggat 661 tacaggcatc ccgtagtgac attaagttat ttaagcataa tgacatggct gacctcgagc 721 gactactaaa agaacaagag atcgaagatc aaaagaatcc tcgcaaggct cgtgtaactc 781 ggcgtttcat tgtagtagaa ggattgtata tgaatactgg aactatttgt cctcttccag 841 aattggttaa gttaaaatac aaatacaaag caagaatctt cctggaggaa agcctttcat 901 ttggagtcct aggagagcat ggccgaggag tcactgaaca ctatggaatc aatattgatg 961 atattgatct tatcagtgcc aacatggaga atgcacttgc ttctattgga ggtttctgct 1021 gtggcaggtc ttttgtaatt gaccatcagc gactttccgg ccagggatac tgcttttcag 1081 cttcgttacc tcccctgtta gctgctgcag caattgaggc cctcaacatc atggaagaga 1141 atccaggtat ttttgcagtg ttgaaggaaa agtgcggaca aattcataaa gctttacaag 1201 gcatttctgg attaaaagtg gtgggggagt ccctttctcc agCCTTTCAC CTACAACTGG 1261 AAGAGAGCAC TGGGTCTCGC GAGCAAGATG TCAGACTGCT TCAGGAAATT GTAGATCAAT 1321 GCATGAACAG AAGTATTGCA TTAACTCGGG CGCGCTACTT GGAGAAAGAA GAGAAGTGTC 1381 TCCCTCCTCC CAGAGGAAGA ACTGGAGAGA GCTGCGTCCA CCATCAAGGA GGTAGCCCAG 1441 GCCGTCCTGC TCTAGGCAGA GTCCCGGGAC CATGGCCTCC TGCCACACAA CACGCAGAGA 1501 GGACTCAAGA CTCCCGCTGG CCATGGAGTG GCCTGAAAGA GAGCAAGAAC ATGTGGATCT 1561 TTGATAGGAT TGTTACCAAA TGGTGTCAGT ATGGACCAAT TGTGTGCCCA ACTTTCTTGT 1621 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1681 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1741 GAAAGGACGA TCTTTGGCAG CTGACGATCT CACAACGCGT TAAGTCgaca atcaacctct 1801 ggattacaaa atttgtgaaa gatt