Transcript: Human XM_024447402.1

PREDICTED: Homo sapiens PC4 and SFRS1 interacting protein 1 (PSIP1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSIP1 (11168)
Length:
1972
CDS:
330..1319

Additional Resources:

NCBI RefSeq record:
XM_024447402.1
NBCI Gene record:
PSIP1 (11168)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293779 ACGCAAGCAAGAGGAACAAAT pLKO_005 1274 CDS 100% 13.200 18.480 N PSIP1 n/a
2 TRCN0000298569 TACTAAGGTCGGCCATCATTC pLKO_005 1636 3UTR 100% 10.800 8.640 N PSIP1 n/a
3 TRCN0000012115 CCCACAAACAAACTACCCATT pLKO.1 435 CDS 100% 4.050 3.240 N Psip1 n/a
4 TRCN0000321213 CCCACAAACAAACTACCCATT pLKO_005 435 CDS 100% 4.050 3.240 N Psip1 n/a
5 TRCN0000298567 TTTAGGACCAAAGGATATATT pLKO_005 485 CDS 100% 15.000 10.500 N PSIP1 n/a
6 TRCN0000074819 GCAGCAACTAAACAATCAAAT pLKO.1 618 CDS 100% 13.200 9.240 N PSIP1 n/a
7 TRCN0000286345 GCAGCAACTAAACAATCAAAT pLKO_005 618 CDS 100% 13.200 9.240 N PSIP1 n/a
8 TRCN0000321149 TGACTAAAGCAGTTGACATAA pLKO_005 727 CDS 100% 13.200 9.240 N Psip1 n/a
9 TRCN0000074820 GCAGCTACAGAAGTCAAGATT pLKO.1 879 CDS 100% 5.625 3.938 N PSIP1 n/a
10 TRCN0000286344 GCAGCTACAGAAGTCAAGATT pLKO_005 879 CDS 100% 5.625 3.938 N PSIP1 n/a
11 TRCN0000074821 AGTTGACATAACTACTCCAAA pLKO.1 737 CDS 100% 4.950 3.465 N PSIP1 n/a
12 TRCN0000074818 GCCCTTCTCTTGACATTCCTT pLKO.1 1837 3UTR 100% 3.000 2.100 N PSIP1 n/a
13 TRCN0000074822 ACCCACAAACAAACTACCCAT pLKO.1 434 CDS 100% 2.640 1.848 N PSIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.