Transcript: Human XM_024447411.1

PREDICTED: Homo sapiens ring finger protein 183 (RNF183), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF183 (138065)
Length:
3886
CDS:
2795..3373

Additional Resources:

NCBI RefSeq record:
XM_024447411.1
NBCI Gene record:
RNF183 (138065)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427057 GGTGACTACGGAGCCTCATTT pLKO_005 3424 3UTR 100% 13.200 18.480 N RNF183 n/a
2 TRCN0000073192 CCCTTCAACAACACGTTCCAT pLKO.1 2849 CDS 100% 3.000 2.400 N RNF183 n/a
3 TRCN0000433306 ATTGTTCAGGCCATGTGTTTG pLKO_005 3489 3UTR 100% 10.800 7.560 N RNF183 n/a
4 TRCN0000073188 CCCAAATAGCAAGTTGCATTT pLKO.1 3690 3UTR 100% 10.800 7.560 N RNF183 n/a
5 TRCN0000433354 CAACCCTCAGTTCCGCATCTT pLKO_005 3262 CDS 100% 4.950 3.465 N RNF183 n/a
6 TRCN0000073190 GTTGCTCATATTCTCCATCTT pLKO.1 3319 CDS 100% 4.950 3.465 N RNF183 n/a
7 TRCN0000420411 TGAGTGCTGTTCCCAGACAAG pLKO_005 3371 CDS 100% 4.050 2.835 N RNF183 n/a
8 TRCN0000073189 CCACTCTTTGAGGGAGTGTTT pLKO.1 3238 CDS 100% 0.495 0.347 N RNF183 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09574 pDONR223 100% 99.6% 98.9% None 244G>A;341A>G n/a
2 ccsbBroad304_09574 pLX_304 0% 99.6% 98.9% V5 244G>A;341A>G n/a
3 TRCN0000469185 ATTATTCTTTATCTTACTGATCAA pLX_317 76.6% 99.6% 98.9% V5 244G>A;341A>G n/a
Download CSV