Transcript: Human XM_024447484.1

PREDICTED: Homo sapiens hydroxyacid oxidase 2 (HAO2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HAO2 (51179)
Length:
1649
CDS:
335..1597

Additional Resources:

NCBI RefSeq record:
XM_024447484.1
NBCI Gene record:
HAO2 (51179)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046124 CGCTGAGATCAATCGAAACTT pLKO.1 1317 CDS 100% 5.625 7.875 N HAO2 n/a
2 TRCN0000046126 CCCTTGGAGCTAAGTGCATTT pLKO.1 1245 CDS 100% 10.800 7.560 N HAO2 n/a
3 TRCN0000046123 CCCATATTTCCCACATTTCTA pLKO.1 1473 CDS 100% 5.625 3.938 N HAO2 n/a
4 TRCN0000046127 GCAGCTGAACAAACAGTTGAT pLKO.1 778 CDS 100% 4.950 3.465 N HAO2 n/a
5 TRCN0000046125 CCAGGGTATCATTGTTTCCAA pLKO.1 1087 CDS 100% 3.000 2.100 N HAO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08241 pDONR223 100% 73.8% 73.6% None (many diffs) n/a
2 ccsbBroad304_08241 pLX_304 0% 73.8% 73.6% V5 (many diffs) n/a
3 TRCN0000471333 TTGCCTCAACAACTTCTACTGGGA pLX_317 37.5% 73.8% 73.6% V5 (many diffs) n/a
Download CSV