Transcript: Human XM_024447532.1

PREDICTED: Homo sapiens zinc finger DHHC-type containing 21 (ZDHHC21), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZDHHC21 (340481)
Length:
1034
CDS:
263..925

Additional Resources:

NCBI RefSeq record:
XM_024447532.1
NBCI Gene record:
ZDHHC21 (340481)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139354 CCTCCATAACTGATCCAGGAA pLKO.1 462 CDS 100% 2.640 3.696 N ZDHHC21 n/a
2 TRCN0000143565 GAAAGGGAGTTCTGGGAATTA pLKO.1 515 CDS 100% 13.200 9.240 N ZDHHC21 n/a
3 TRCN0000278260 GAAAGGGAGTTCTGGGAATTA pLKO_005 515 CDS 100% 13.200 9.240 N ZDHHC21 n/a
4 TRCN0000140807 GCAGCCTTTATGGGCATTACT pLKO.1 809 CDS 100% 5.625 3.938 N ZDHHC21 n/a
5 TRCN0000144923 GTTGGAATAACTGGACTCTTT pLKO.1 836 CDS 100% 4.950 3.465 N ZDHHC21 n/a
6 TRCN0000297428 GTTGGAATAACTGGACTCTTT pLKO_005 836 CDS 100% 4.950 3.465 N ZDHHC21 n/a
7 TRCN0000143485 GAAGGACATATTCCAGGCATA pLKO.1 386 CDS 100% 4.050 2.835 N ZDHHC21 n/a
8 TRCN0000278261 GAAGGACATATTCCAGGCATA pLKO_005 386 CDS 100% 4.050 2.835 N ZDHHC21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10027 pDONR223 100% 81.9% 79.6% None (many diffs) n/a
Download CSV