Transcript: Human XM_024447549.1

PREDICTED: Homo sapiens family with sequence similarity 166 member A (FAM166A), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM166A (401565)
Length:
942
CDS:
56..871

Additional Resources:

NCBI RefSeq record:
XM_024447549.1
NBCI Gene record:
FAM166A (401565)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121721 CATGTCCAAACCCAAGTTCAT pLKO.1 229 CDS 100% 4.950 6.930 N FAM166A n/a
2 TRCN0000142072 CCATGTCCAAACCCAAGTTCA pLKO.1 228 CDS 100% 4.950 3.465 N FAM166A n/a
3 TRCN0000143569 GAAGCCCTCTAAGAACTTTGA pLKO.1 331 CDS 100% 4.950 3.465 N FAM166A n/a
4 TRCN0000141555 CCCAAGTTCATTGAGGACTTC pLKO.1 239 CDS 100% 4.050 2.835 N FAM166A n/a
5 TRCN0000142073 CCCTAACCTAATCCAACGCAA pLKO.1 676 CDS 100% 2.640 1.848 N FAM166A n/a
6 TRCN0000141789 GAACTTTGAGATTCTGGGCCA pLKO.1 343 CDS 100% 0.540 0.378 N FAM166A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447549.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05650 pDONR223 100% 77.9% 68.9% None (many diffs) n/a
2 ccsbBroad304_05650 pLX_304 0% 77.9% 68.9% V5 (many diffs) n/a
3 TRCN0000466702 TCCCTAACAGCGACTTTGAGTTTG pLX_317 44.5% 77.9% 68.9% V5 (many diffs) n/a
Download CSV