Transcript: Human XM_024447719.1

PREDICTED: Homo sapiens TNF superfamily member 8 (TNFSF8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNFSF8 (944)
Length:
3168
CDS:
372..1004

Additional Resources:

NCBI RefSeq record:
XM_024447719.1
NBCI Gene record:
TNFSF8 (944)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447719.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058167 CATTCCCAACTCACCTGACAA pLKO.1 572 CDS 100% 4.950 6.930 N TNFSF8 n/a
2 TRCN0000420001 ACTGTATGGTCTTGATCTATT pLKO_005 1292 3UTR 100% 13.200 10.560 N TNFSF8 n/a
3 TRCN0000058164 GTGGATACATTCCAGTACATA pLKO.1 921 CDS 100% 5.625 4.500 N TNFSF8 n/a
4 TRCN0000427698 CAAACTACACAGGGTATTAAA pLKO_005 1101 3UTR 100% 15.000 10.500 N TNFSF8 n/a
5 TRCN0000058163 CCTGGTTTGTACTTCATCATT pLKO.1 705 CDS 100% 5.625 3.938 N TNFSF8 n/a
6 TRCN0000058165 CTCATCAACAAGCATATCAAA pLKO.1 786 CDS 100% 5.625 3.938 N TNFSF8 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 35 5UTR 100% 4.950 2.475 Y KAAG1 n/a
8 TRCN0000178741 CACACACATACACACACACAA pLKO.1 53 5UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447719.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00256 pDONR223 100% 89.7% 89.7% None 236_237ins72 n/a
2 ccsbBroad304_00256 pLX_304 0% 89.7% 89.7% V5 236_237ins72 n/a
3 TRCN0000477777 GCGAATACTCCCGTGCCGTCTTTA pLX_317 47.8% 89.7% 89.7% V5 236_237ins72 n/a
Download CSV