Transcript: Human XM_024447857.1

PREDICTED: Homo sapiens tRNA aspartic acid methyltransferase 1 (TRDMT1), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRDMT1 (1787)
Length:
9799
CDS:
311..1207

Additional Resources:

NCBI RefSeq record:
XM_024447857.1
NBCI Gene record:
TRDMT1 (1787)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234957 AGCGTTTATAACACCATTATT pLKO_005 2472 3UTR 100% 15.000 21.000 N TRDMT1 n/a
2 TRCN0000234955 ATACTTAAACTGCGATATTTC pLKO_005 1040 CDS 100% 13.200 18.480 N TRDMT1 n/a
3 TRCN0000234954 CAAATTCAAGGCTACGATATT pLKO_005 501 CDS 100% 13.200 18.480 N TRDMT1 n/a
4 TRCN0000234953 ATGTCAACACTGTCGCTAATG pLKO_005 131 5UTR 100% 10.800 15.120 N TRDMT1 n/a
5 TRCN0000035650 CGTGTGCTTTACCAAAGGATA pLKO.1 901 CDS 100% 4.950 6.930 N TRDMT1 n/a
6 TRCN0000035651 GCGCTGAGAGAAAGCTGTATA pLKO.1 85 5UTR 100% 13.200 10.560 N TRDMT1 n/a
7 TRCN0000234956 ACGTGCATGTAGTAGCTAAAC pLKO_005 1164 CDS 100% 10.800 8.640 N TRDMT1 n/a
8 TRCN0000035653 CCAAAGTCATTGCTGCGATAT pLKO.1 839 CDS 100% 10.800 7.560 N TRDMT1 n/a
9 TRCN0000035649 GCAGAAGAAATTCACAGGAAA pLKO.1 734 CDS 100% 4.950 3.465 N TRDMT1 n/a
10 TRCN0000072698 CAGATCATAAGGTCAGGAGAT pLKO.1 8844 3UTR 100% 4.050 2.430 N MRTO4 n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 8807 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 8807 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06114 pDONR223 100% 76% 75.9% None (many diffs) n/a
2 ccsbBroad304_06114 pLX_304 0% 76% 75.9% V5 (many diffs) n/a
3 TRCN0000477725 GCCCGCAAACCTTTGAGACGGGCG pLX_317 38% 76% 75.9% V5 (many diffs) n/a
Download CSV