Transcript: Human XM_024447921.1

PREDICTED: Homo sapiens GTP binding protein 4 (GTPBP4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GTPBP4 (23560)
Length:
2369
CDS:
548..1825

Additional Resources:

NCBI RefSeq record:
XM_024447921.1
NBCI Gene record:
GTPBP4 (23560)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447921.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247929 TGTTGGGCACATGGATTATAA pLKO_005 538 5UTR 100% 15.000 21.000 N Gtpbp4 n/a
2 TRCN0000294070 TGTCGGAATCCCGTGCTTAAA pLKO_005 2174 3UTR 100% 13.200 18.480 N GTPBP4 n/a
3 TRCN0000047976 GCGTAGTCTTGGTGTTGACAT pLKO.1 1492 CDS 100% 4.950 6.930 N GTPBP4 n/a
4 TRCN0000286716 GCGTAGTCTTGGTGTTGACAT pLKO_005 1492 CDS 100% 4.950 6.930 N GTPBP4 n/a
5 TRCN0000047974 GCTGGAGAGTATGACAGTGTA pLKO.1 1307 CDS 100% 4.950 6.930 N GTPBP4 n/a
6 TRCN0000286790 GCTGGAGAGTATGACAGTGTA pLKO_005 1307 CDS 100% 4.950 6.930 N GTPBP4 n/a
7 TRCN0000047973 GCGTCAGCATTTATCCCGTTT pLKO.1 382 5UTR 100% 4.050 5.670 N GTPBP4 n/a
8 TRCN0000286714 GCGTCAGCATTTATCCCGTTT pLKO_005 382 5UTR 100% 4.050 5.670 N GTPBP4 n/a
9 TRCN0000047977 GCTCATCGAGTGGAAACCAAA pLKO.1 941 CDS 100% 4.950 3.960 N GTPBP4 n/a
10 TRCN0000286791 GCTCATCGAGTGGAAACCAAA pLKO_005 941 CDS 100% 4.950 3.960 N GTPBP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447921.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07905 pDONR223 100% 66.9% 67% None 0_1ins627;123G>A n/a
Download CSV