Transcript: Human XM_024447972.1

PREDICTED: Homo sapiens HPS1 biogenesis of lysosomal organelles complex 3 subunit 1 (HPS1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HPS1 (3257)
Length:
3578
CDS:
1096..2226

Additional Resources:

NCBI RefSeq record:
XM_024447972.1
NBCI Gene record:
HPS1 (3257)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381345 GCTTGGTGCACTTCATCTATG pLKO_005 1742 CDS 100% 10.800 15.120 N HPS1 n/a
2 TRCN0000382212 AGCACCTGGCTGGAGTTTAAG pLKO_005 1459 CDS 100% 13.200 10.560 N HPS1 n/a
3 TRCN0000379764 ACTGGACAGATCAGGAGTTTG pLKO_005 270 5UTR 100% 10.800 7.560 N HPS1 n/a
4 TRCN0000379465 ACTTCCTGTGGTTCGAGAATG pLKO_005 1955 CDS 100% 10.800 7.560 N HPS1 n/a
5 TRCN0000379770 CCATGGATGCCCTTCAGATAG pLKO_005 1094 5UTR 100% 10.800 7.560 N HPS1 n/a
6 TRCN0000381812 GCCAGAGGATGGACAAGTTTG pLKO_005 1409 CDS 100% 10.800 7.560 N HPS1 n/a
7 TRCN0000082870 CCTGTGGTTCGAGAATGACAT pLKO.1 1959 CDS 100% 4.950 3.465 N HPS1 n/a
8 TRCN0000201507 CCTGTGGTTCGAGAATGACAT pLKO.1 1959 CDS 100% 4.950 3.465 N Hps1 n/a
9 TRCN0000082868 GCTCAATAAATGTTGGTCATT pLKO.1 2737 3UTR 100% 4.950 3.465 N HPS1 n/a
10 TRCN0000082869 GTCCTCTTCTACTGGACAGAT pLKO.1 260 5UTR 100% 4.950 3.465 N HPS1 n/a
11 TRCN0000082872 CCTGTATGTCCTTCACCTGTT pLKO.1 460 5UTR 100% 4.050 2.835 N HPS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447972.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.