Transcript: Human XM_024448060.1

PREDICTED: Homo sapiens oleoyl-ACP hydrolase (OLAH), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OLAH (55301)
Length:
1707
CDS:
291..1088

Additional Resources:

NCBI RefSeq record:
XM_024448060.1
NBCI Gene record:
OLAH (55301)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048941 GTCTAGAAGTATCATCGATAT pLKO.1 1057 CDS 100% 10.800 15.120 N OLAH n/a
2 TRCN0000048942 GAAACAATGTAGTCCCATCAT pLKO.1 809 CDS 100% 4.950 6.930 N OLAH n/a
3 TRCN0000048939 GCACCTCTAACGTACCATCTA pLKO.1 859 CDS 100% 4.950 6.930 N OLAH n/a
4 TRCN0000048940 GCTGATTTGCTTTCCCTGGAT pLKO.1 374 CDS 100% 2.640 3.696 N OLAH n/a
5 TRCN0000048938 CCAGAACCATTGCATTTATTT pLKO.1 648 CDS 100% 15.000 10.500 N OLAH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08509 pDONR223 100% 99.8% 99.6% None 13G>A n/a
2 ccsbBroad304_08509 pLX_304 0% 99.8% 99.6% V5 13G>A n/a
3 TRCN0000474027 ATAGAATTAACATACCTAGTCCGG pLX_317 60.6% 99.8% 99.6% V5 13G>A n/a
Download CSV