Transcript: Human XM_024448093.1

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type E (PTPRE), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRE (5791)
Length:
5158
CDS:
2372..3814

Additional Resources:

NCBI RefSeq record:
XM_024448093.1
NBCI Gene record:
PTPRE (5791)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315199 GGTCAAATAATATCCCATAAA pLKO_005 4007 3UTR 100% 13.200 18.480 N PTPRE n/a
2 TRCN0000002893 CCGAGTGATCCTTTCCATGAA pLKO.1 3109 CDS 100% 4.950 6.930 N PTPRE n/a
3 TRCN0000315196 CCGAGTGATCCTTTCCATGAA pLKO_005 3109 CDS 100% 4.950 6.930 N PTPRE n/a
4 TRCN0000235613 AGGATAAATGCTACCAGTATT pLKO_005 3309 CDS 100% 13.200 9.240 N Ptpre n/a
5 TRCN0000315212 AGGATAAATGCTACCAGTATT pLKO_005 3309 CDS 100% 13.200 9.240 N PTPRE n/a
6 TRCN0000315198 CTGCGACCATCGTCATGTTAA pLKO_005 2391 CDS 100% 13.200 9.240 N PTPRE n/a
7 TRCN0000002894 GCTACCGACAGAAGGACTATT pLKO.1 3177 CDS 100% 13.200 9.240 N PTPRE n/a
8 TRCN0000315197 GCTACCGACAGAAGGACTATT pLKO_005 3177 CDS 100% 13.200 9.240 N PTPRE n/a
9 TRCN0000381158 TCATAGCCCTCAGCAACATTT pLKO_005 3630 CDS 100% 13.200 9.240 N PTPRE n/a
10 TRCN0000002895 ACGTTCATCTACCAAGCCTTA pLKO.1 2864 CDS 100% 4.050 2.835 N PTPRE n/a
11 TRCN0000010744 CAAGAAGATGCCCAACGGAAT pLKO.1 684 5UTR 100% 4.050 2.835 N PTPRE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448093.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06817 pDONR223 100% 68.4% 68.5% None (many diffs) n/a
2 ccsbBroad304_06817 pLX_304 0% 68.4% 68.5% V5 (many diffs) n/a
3 TRCN0000478447 GGGGGCCTAAGAAGTTATTTTTAG pLX_317 13.3% 68.4% 68.5% V5 (many diffs) n/a
Download CSV