Transcript: Human XM_024448222.1

PREDICTED: Homo sapiens solute carrier family 25 member 28 (SLC25A28), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A28 (81894)
Length:
1327
CDS:
203..1000

Additional Resources:

NCBI RefSeq record:
XM_024448222.1
NBCI Gene record:
SLC25A28 (81894)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236528 AGTGCCTTCAGGACGGTATAT pLKO_005 833 CDS 100% 13.200 18.480 N SLC25A28 n/a
2 TRCN0000043923 GCAGATGTACAACTCACCATA pLKO.1 499 CDS 100% 4.950 6.930 N SLC25A28 n/a
3 TRCN0000043925 CGCATGGTCTGTGTATGAGTT pLKO.1 928 CDS 100% 4.950 3.960 N SLC25A28 n/a
4 TRCN0000236529 AGGCCCTCTGGAGGATTATAA pLKO_005 252 CDS 100% 15.000 10.500 N SLC25A28 n/a
5 TRCN0000236531 GGTGCAGGCCAGAGTAATTTA pLKO_005 886 CDS 100% 15.000 10.500 N SLC25A28 n/a
6 TRCN0000043927 CTTGGCTTTGAACTCACACAT pLKO.1 787 CDS 100% 4.950 3.465 N SLC25A28 n/a
7 TRCN0000043924 GCTGACCATGAACGTTCCTTT pLKO.1 598 CDS 100% 4.950 3.465 N SLC25A28 n/a
8 TRCN0000043926 CTCACACATTACAGGACATAT pLKO.1 799 CDS 100% 13.200 7.920 N SLC25A28 n/a
9 TRCN0000236530 CTGTGTATGAGTTCTTCAAAT pLKO_005 936 CDS 100% 13.200 7.920 N SLC25A28 n/a
10 TRCN0000236527 TGCTGCATCCTGGTCACATTC pLKO_005 1037 3UTR 100% 10.800 6.480 N SLC25A28 n/a
11 TRCN0000069611 GCAGAGGATGCAGATGTACAA pLKO.1 490 CDS 100% 4.950 2.970 N Slc25a28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.