Transcript: Human XM_024448248.1

PREDICTED: Homo sapiens acyl-CoA binding domain containing 5 (ACBD5), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACBD5 (91452)
Length:
1534
CDS:
86..1519

Additional Resources:

NCBI RefSeq record:
XM_024448248.1
NBCI Gene record:
ACBD5 (91452)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419110 GTATTACTTGGGTGGTCATTC pLKO_005 889 CDS 100% 10.800 15.120 N ACBD5 n/a
2 TRCN0000107026 CCGTTAATGGTAAAGCTGAAA pLKO.1 648 CDS 100% 4.950 6.930 N ACBD5 n/a
3 TRCN0000107028 GCACAGTGGTTGGTGTATTTA pLKO.1 1439 CDS 100% 15.000 10.500 N ACBD5 n/a
4 TRCN0000215426 GGATCCTATTGGAAGATATAA pLKO.1 364 CDS 100% 15.000 10.500 N Acbd5 n/a
5 TRCN0000246870 GGATCCTATTGGAAGATATAA pLKO_005 364 CDS 100% 15.000 10.500 N Acbd5 n/a
6 TRCN0000432358 GGATCCTATTGGAAGATATAA pLKO_005 364 CDS 100% 15.000 10.500 N ACBD5 n/a
7 TRCN0000422744 TGTGATTCTATGGAACAATTT pLKO_005 818 CDS 100% 13.200 9.240 N ACBD5 n/a
8 TRCN0000107029 GAAGAGTCTTTAGACAGCTTT pLKO.1 845 CDS 100% 4.950 3.465 N ACBD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09315 pDONR223 100% 76.9% 77% None (many diffs) n/a
2 ccsbBroad304_09315 pLX_304 0% 76.9% 77% V5 (many diffs) n/a
3 TRCN0000480091 TGGGTGCCGGCCACGGCTCACCGA pLX_317 26.9% 76.9% 77% V5 (many diffs) n/a
Download CSV