Transcript: Human XM_024448355.1

PREDICTED: Homo sapiens sestrin 3 (SESN3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SESN3 (143686)
Length:
9496
CDS:
537..1781

Additional Resources:

NCBI RefSeq record:
XM_024448355.1
NBCI Gene record:
SESN3 (143686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412760 ATCTGATGTCTCTCGATATAT pLKO_005 1265 CDS 100% 15.000 12.000 N SESN3 n/a
2 TRCN0000432269 GGTCTACAATCTCACATATAA pLKO_005 1445 CDS 100% 15.000 10.500 N SESN3 n/a
3 TRCN0000428761 GGCTAATATCAGTCAACAATT pLKO_005 976 CDS 100% 13.200 9.240 N SESN3 n/a
4 TRCN0000088252 GCCTTAATGGAAAGGATGAAA pLKO.1 1092 CDS 100% 5.625 3.938 N Sesn3 n/a
5 TRCN0000141228 CCCATGAGGATGTTGACACAA pLKO.1 1477 CDS 100% 4.950 3.465 N SESN3 n/a
6 TRCN0000143446 GCTATCCTGAGAGAACTACAA pLKO.1 1627 CDS 100% 4.950 3.465 N SESN3 n/a
7 TRCN0000122213 GCTGAACTTCTTTATGCTCTT pLKO.1 1734 CDS 100% 4.050 2.835 N SESN3 n/a
8 TRCN0000144279 CGTACTAACTTTCTTGTGGAA pLKO.1 474 5UTR 100% 2.640 1.848 N SESN3 n/a
9 TRCN0000144367 CAGTTCTCTAGTGTCAAAGTT pLKO.1 1874 3UTR 100% 5.625 3.375 N SESN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13218 pDONR223 100% 48.3% 47% None (many diffs) n/a
2 ccsbBroad304_13218 pLX_304 0% 48.3% 47% V5 (many diffs) n/a
3 TRCN0000473047 ATGGACTATCATGTATGCTTCAAC pLX_317 45% 48.3% 47% V5 (many diffs) n/a
Download CSV