Transcript: Human XM_024448435.1

PREDICTED: Homo sapiens SERTA domain containing 4 (SERTAD4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SERTAD4 (56256)
Length:
5183
CDS:
201..1271

Additional Resources:

NCBI RefSeq record:
XM_024448435.1
NBCI Gene record:
SERTAD4 (56256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421469 ACGATTGACTTAATGCTTAAA pLKO_005 1485 3UTR 100% 13.200 18.480 N SERTAD4 n/a
2 TRCN0000412619 CAGTTAATTAGGGAGTTATTT pLKO_005 1629 3UTR 100% 15.000 12.000 N SERTAD4 n/a
3 TRCN0000426539 GGGAATTTCAAATCCTATAAC pLKO_005 389 CDS 100% 13.200 10.560 N SERTAD4 n/a
4 TRCN0000116085 CCTCCGAAGATCTGTCCTTAT pLKO.1 575 CDS 100% 10.800 8.640 N SERTAD4 n/a
5 TRCN0000247970 TTTGAGTGCAAAGGCCAATTT pLKO_005 1122 CDS 100% 13.200 9.240 N Sertad4 n/a
6 TRCN0000116083 GCATCTATTTACAAGAGTGAT pLKO.1 951 CDS 100% 4.950 3.465 N SERTAD4 n/a
7 TRCN0000116086 CTGTCAATGCTAATGTTGGAA pLKO.1 814 CDS 100% 3.000 2.100 N SERTAD4 n/a
8 TRCN0000116084 CCACATCCTTTATATGTCCTT pLKO.1 518 CDS 100% 2.640 1.848 N SERTAD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03714 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03714 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480559 CGGATCATAGTTGCTGAAGCTAAG pLX_317 36.5% 100% 100% V5 n/a
Download CSV