Transcript: Human XM_024448440.1

PREDICTED: Homo sapiens dickkopf WNT signaling pathway inhibitor 3 (DKK3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DKK3 (27122)
Length:
693
CDS:
28..678

Additional Resources:

NCBI RefSeq record:
XM_024448440.1
NBCI Gene record:
DKK3 (27122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448440.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033398 GACACGAAGGTTGGAAATAAT pLKO.1 517 CDS 100% 15.000 10.500 N DKK3 n/a
2 TRCN0000033395 GCAAACTTACCTCCCAGCTAT pLKO.1 478 CDS 100% 4.950 3.465 N DKK3 n/a
3 TRCN0000033394 GCACCGAGAAATTCACAAGAT pLKO.1 549 CDS 100% 4.950 3.465 N DKK3 n/a
4 TRCN0000033397 GCTGCTAAAGCATCATCAGAA pLKO.1 448 CDS 100% 4.950 3.465 N DKK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448440.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08057 pDONR223 100% 36.5% 35.5% None (many diffs) n/a
2 ccsbBroad304_08057 pLX_304 0% 36.5% 35.5% V5 (many diffs) n/a
3 TRCN0000472220 GCGCGAATCTCTACGAAAAGAAAT pLX_317 26.9% 36.5% 35.5% V5 (many diffs) n/a
Download CSV