Transcript: Human XM_024448669.1

PREDICTED: Homo sapiens troponin T3, fast skeletal type (TNNT3), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNNT3 (7140)
Length:
1024
CDS:
42..812

Additional Resources:

NCBI RefSeq record:
XM_024448669.1
NBCI Gene record:
TNNT3 (7140)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448669.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415286 AGATTGACAAGTTCGAGTTTG pLKO_005 667 CDS 100% 10.800 15.120 N TNNT3 n/a
2 TRCN0000437176 CAAGCCGCTCAACATCGATCA pLKO_005 584 CDS 100% 4.050 5.670 N TNNT3 n/a
3 TRCN0000082878 GCGTCAGAACAAAGACCTAAT pLKO.1 221 CDS 100% 10.800 7.560 N TNNT3 n/a
4 TRCN0000437280 AGAACAGACTGGCGGAGGAAA pLKO_005 388 CDS 100% 4.950 3.465 N TNNT3 n/a
5 TRCN0000082881 CCAAACTCACTGCTCCTAAGA pLKO.1 157 CDS 100% 4.950 3.465 N TNNT3 n/a
6 TRCN0000082882 GAAACGCCAGAAATATGACAT pLKO.1 698 CDS 100% 4.950 3.465 N TNNT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448669.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01694 pDONR223 100% 97.5% 97.2% None 67_81del;93T>A;96_98delACC n/a
2 ccsbBroad304_01694 pLX_304 0% 97.5% 97.2% V5 67_81del;93T>A;96_98delACC n/a
3 TRCN0000470757 CTCGCATCGCGGTAGACAAGGGCC pLX_317 52.9% 97.5% 97.2% V5 67_81del;93T>A;96_98delACC n/a
Download CSV