Transcript: Human XM_024448743.1

PREDICTED: Homo sapiens DIX domain containing 1 (DIXDC1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DIXDC1 (85458)
Length:
5744
CDS:
256..2196

Additional Resources:

NCBI RefSeq record:
XM_024448743.1
NBCI Gene record:
DIXDC1 (85458)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431918 GCAAAGAGCGAGTCCATTATA pLKO_005 829 CDS 100% 15.000 21.000 N DIXDC1 n/a
2 TRCN0000134516 GAACTCAAGTAGGTAGTGAAT pLKO.1 1853 CDS 100% 4.950 6.930 N DIXDC1 n/a
3 TRCN0000425515 AGAGCTACTGAGGGCAAATAT pLKO_005 1314 CDS 100% 15.000 10.500 N DIXDC1 n/a
4 TRCN0000138927 GCAGGGATCATTCTGGGTAAA pLKO.1 3269 3UTR 100% 10.800 7.560 N DIXDC1 n/a
5 TRCN0000137219 GCTATTGATCGGGAAGGAAAT pLKO.1 2041 CDS 100% 10.800 7.560 N DIXDC1 n/a
6 TRCN0000137860 GAGCGAGAGCTAGAACACAAA pLKO.1 1519 CDS 100% 4.950 3.465 N DIXDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09267 pDONR223 100% 72.6% 71.9% None (many diffs) n/a
2 ccsbBroad304_09267 pLX_304 0% 72.6% 71.9% V5 (many diffs) n/a
3 TRCN0000480287 CACCAATGGAACCAATAGCGAGGA pLX_317 26.6% 72.6% 71.9% V5 (many diffs) n/a
Download CSV