Transcript: Human XM_024448851.1

PREDICTED: Homo sapiens transmembrane protein 120B (TMEM120B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM120B (144404)
Length:
1564
CDS:
145..888

Additional Resources:

NCBI RefSeq record:
XM_024448851.1
NBCI Gene record:
TMEM120B (144404)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253825 GCCACGTGGTGAGGGTTATTT pLKO_005 1530 3UTR 100% 15.000 10.500 N TMEM120B n/a
2 TRCN0000253826 GCGTCCAGTTCCTGCAATATT pLKO_005 699 CDS 100% 15.000 10.500 N TMEM120B n/a
3 TRCN0000253824 ACAATGCCGTCACGCTGTTTG pLKO_005 867 CDS 100% 10.800 7.560 N TMEM120B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04972 pDONR223 100% 72.8% 52.8% None 551_552ins128;741_742ins148 n/a
2 ccsbBroad304_04972 pLX_304 0% 72.8% 52.8% V5 551_552ins128;741_742ins148 n/a
3 TRCN0000475722 TTGTGTATCCTCCCTATATCATTT pLX_317 34% 72.8% 52.8% V5 551_552ins128;741_742ins148 n/a
Download CSV