Transcript: Human XM_024448909.1

PREDICTED: Homo sapiens ATP binding cassette subfamily B member 9 (ABCB9), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCB9 (23457)
Length:
2410
CDS:
896..2176

Additional Resources:

NCBI RefSeq record:
XM_024448909.1
NBCI Gene record:
ABCB9 (23457)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303627 TCCGCCACTTCAACATCTTTG pLKO_005 368 5UTR 100% 10.800 15.120 N ABCB9 n/a
2 TRCN0000060196 CATCACGGATAACATCTCCTA pLKO.1 1837 CDS 100% 2.640 3.696 N ABCB9 n/a
3 TRCN0000303691 TGTTCGTGTGGACGTACATTT pLKO_005 611 5UTR 100% 13.200 9.240 N ABCB9 n/a
4 TRCN0000060193 CTCTCCAAAGAGGTCCAGAAT pLKO.1 1298 CDS 100% 4.950 3.465 N ABCB9 n/a
5 TRCN0000060194 GATGGCATCGTCATCCAGAAA pLKO.1 895 5UTR 100% 4.950 3.465 N ABCB9 n/a
6 TRCN0000299388 GATGGCATCGTCATCCAGAAA pLKO_005 895 5UTR 100% 4.950 3.465 N ABCB9 n/a
7 TRCN0000060195 CTGTGTCAACATCCTGGAGAA pLKO.1 1693 CDS 100% 4.050 2.430 N ABCB9 n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2360 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2360 3UTR 100% 4.950 2.475 Y C19orf31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11737 pDONR223 100% 43.9% 39.6% None (many diffs) n/a
2 ccsbBroad304_11737 pLX_304 0% 43.9% 39.6% V5 (many diffs) n/a
3 TRCN0000468050 TGATTGCTCCTTTTCCACACCAGA pLX_317 21.7% 43.9% 39.6% V5 (many diffs) n/a
Download CSV