Transcript: Human XM_024448963.1

PREDICTED: Homo sapiens TAFA chemokine like family member 2 (TAFA2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAFA2 (338811)
Length:
2700
CDS:
169..567

Additional Resources:

NCBI RefSeq record:
XM_024448963.1
NBCI Gene record:
TAFA2 (338811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137296 GTGGATGCTTCAATAGTGGAA pLKO.1 424 CDS 100% 2.640 3.696 N TAFA2 n/a
2 TRCN0000138849 GCACTCCACAGATGCTGTAAT pLKO.1 313 CDS 100% 13.200 9.240 N TAFA2 n/a
3 TRCN0000138707 GCTGTTCCTCTGGGAATAAAG pLKO.1 521 CDS 100% 13.200 9.240 N TAFA2 n/a
4 TRCN0000135870 CATCATAAAGCTCACCATGTT pLKO.1 268 CDS 100% 4.950 3.465 N TAFA2 n/a
5 TRCN0000136006 GAAAGTTGTATCCAGTGCAAA pLKO.1 246 CDS 100% 4.950 3.465 N TAFA2 n/a
6 TRCN0000135554 GCTTCAATAGTGGAACAGAAA pLKO.1 430 CDS 100% 4.950 3.465 N TAFA2 n/a
7 TRCN0000136970 CCATCATAAAGCTCACCATGT pLKO.1 267 CDS 100% 4.050 2.835 N TAFA2 n/a
8 TRCN0000135896 GAATGTAAAGTTCTTCCGGAT pLKO.1 487 CDS 100% 2.160 1.512 N TAFA2 n/a
9 TRCN0000177424 GCTGTAATAAGAACAAGATAG pLKO.1 326 CDS 100% 10.800 6.480 N Fam19a2 n/a
10 TRCN0000137568 CACAAACAGTCAAGTGCTCCT pLKO.1 356 CDS 100% 2.160 1.296 N TAFA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13581 pDONR223 100% 98.7% 97.7% None 1_3delATG;158G>A;203G>A n/a
2 ccsbBroad304_13581 pLX_304 0% 98.7% 97.7% V5 1_3delATG;158G>A;203G>A n/a
3 TRCN0000477466 ATATCTCGGTCGGCCGAACTTTGC pLX_317 98.5% 98.7% 97.7% V5 1_3delATG;158G>A;203G>A n/a
Download CSV