Transcript: Human XM_024449100.1

PREDICTED: Homo sapiens phosphatidylinositol transfer protein membrane associated 2 (PITPNM2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PITPNM2 (57605)
Length:
7018
CDS:
362..4471

Additional Resources:

NCBI RefSeq record:
XM_024449100.1
NBCI Gene record:
PITPNM2 (57605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437987 TGACGGGCAGGTTCATGTATG pLKO_005 3480 CDS 100% 10.800 15.120 N PITPNM2 n/a
2 TRCN0000430226 CATCATAGAGGACGAGGTTAG pLKO_005 1378 CDS 100% 6.000 8.400 N PITPNM2 n/a
3 TRCN0000029765 GCTCATGCTTTCCCGTAAGAT pLKO.1 913 CDS 100% 5.625 7.875 N PITPNM2 n/a
4 TRCN0000029766 CCAGCAAGTCTACAACCTCTT pLKO.1 2419 CDS 100% 4.050 3.240 N PITPNM2 n/a
5 TRCN0000439434 GATGCCCTGTGCTACAGTAAC pLKO_005 1868 CDS 100% 10.800 7.560 N PITPNM2 n/a
6 TRCN0000029767 CCAGCTGACAATCGACTTCAT pLKO.1 565 CDS 100% 4.950 3.465 N PITPNM2 n/a
7 TRCN0000029768 CTTTGAGATCACCGACCTCTT pLKO.1 2311 CDS 100% 4.050 2.835 N PITPNM2 n/a
8 TRCN0000100465 GCCTTCTCTTTGATTTCTAAA pLKO.1 6750 3UTR 100% 13.200 7.920 N Pitpnm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.