Transcript: Human XM_024449190.1

PREDICTED: Homo sapiens ring finger protein 34 (RNF34), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF34 (80196)
Length:
2135
CDS:
238..1359

Additional Resources:

NCBI RefSeq record:
XM_024449190.1
NBCI Gene record:
RNF34 (80196)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033951 CGGCACAGGTACAAAGTGAAA pLKO.1 866 CDS 100% 4.950 6.930 N RNF34 n/a
2 TRCN0000298800 CGGCACAGGTACAAAGTGAAA pLKO_005 866 CDS 100% 4.950 6.930 N RNF34 n/a
3 TRCN0000033949 CCCTCAGTTAATGCGACTGAA pLKO.1 576 CDS 100% 0.495 0.693 N RNF34 n/a
4 TRCN0000033952 GCAGTATCTCATTCTGAGAAA pLKO.1 612 CDS 100% 4.950 3.960 N RNF34 n/a
5 TRCN0000298752 GCAGTATCTCATTCTGAGAAA pLKO_005 612 CDS 100% 4.950 3.960 N RNF34 n/a
6 TRCN0000233439 GGCACAGGTACAAAGTGAAAT pLKO_005 867 CDS 100% 13.200 9.240 N Rnf34 n/a
7 TRCN0000033953 GCATGTTTGCTGTGACTGCAA pLKO.1 465 CDS 100% 2.640 1.848 N RNF34 n/a
8 TRCN0000298799 GCATGTTTGCTGTGACTGCAA pLKO_005 465 CDS 100% 2.640 1.848 N RNF34 n/a
9 TRCN0000033950 GCCTTGATGATGTGGAAGGAA pLKO.1 1019 CDS 100% 3.000 1.800 N RNF34 n/a
10 TRCN0000298797 GCCTTGATGATGTGGAAGGAA pLKO_005 1019 CDS 100% 3.000 1.800 N RNF34 n/a
11 TRCN0000037290 GCACAGGTACAAAGTGAAATA pLKO.1 868 CDS 100% 13.200 9.240 N Rnf34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04187 pDONR223 100% 99.6% 99.4% None 1_3delATG;5G>T n/a
2 ccsbBroad304_04187 pLX_304 0% 99.6% 99.4% V5 1_3delATG;5G>T n/a
3 TRCN0000481577 ATTTTATTCAAGTGATTGCGGGAT pLX_317 48.8% 99.6% 99.4% V5 1_3delATG;5G>T n/a
Download CSV